Skip to content

Tutorial

Real-time monitoring mapping results with seqkit bam in time-critical situations

Some of SeqKit subcommands, including watch, fish, scat, bam, aid the real-time, streaming processing of data in FASTQ/FASTA and BAM formats, enabling the development of analysis pipelines in time-critical situations. To illustrate the possibilities opened up by the these features, we present a small pipeline which maps a dataset of SARS-CoV-2 amplicon reads to the reference sequence using minimap2 as they are being downloaded. The stream of SAM alignments is then converted into a stream of BAM records and passed to seqkit bam, which filters for records with aligned reference lengths between 310 and 410 and displays the distribution of aligned reference lengths after every 5000 records also saving it to a PDF file. The next element of the pipeline is another instance of the seqkit bam subcommand, which displays the distribution of alignment accuracies after every 10000 records. The stream of BAM records is then passed on to samtools sort to produce the final sorted BAM file. Finally, seqkit bam is used to display detailed alignment statistics from the final sorted BAM file in a pretty format.

#!/bin/bash
set -o nounset

# Define reference and data URL:
REF_URL="https://www.ncbi.nlm.nih.gov/sviewer/viewer.cgi?tool=portal&save=file&log$=seqview&db=nuccore&report=fasta&id=1798174254&extrafeat=null&conwithfeat=on&hide-cdd=on&ncbi_phid=CE8B108356DDCF110000000005B10489"
DATA_URL="http://ftp.sra.ebi.ac.uk/vol1/fastq/SRR145/055/SRR14560555/SRR14560555_1.fastq.gz"

# Map SARS-CoV-2 amplicon reads to reference followed by these steps:
# - keep only primary reads with mapping quality greater than 1.
# - Keep only alignments which align to a reference segments with lengths between 310 and 420.
#   Show an approximate histogram of aligned reference lengths after every 5000 records.
# - Show an approximate histogram of alignment accuracy after every 10000 records.
# - Pipe the BAM into samtools for sorting.
minimap2 -K 10M -t 8 -ax map-ont \
        <(wget -q -O - "$REF_URL") \
        <(wget -q -O - "$DATA_URL") 2>/dev/null \
    | samtools view -F 2304 -q 1 -b - \
    | seqkit bam -O aln_len.pdf -f RefAln -m 310 -M 410 -p 5000 -x - \
    | seqkit bam -O aln_acc.pdf -f Acc  -p 10000 -x - \
    | samtools sort -o sars_artic_sorted.bam -

# Show statistics from the sorted BAM:
seqkit bam -s -k sars_artic_sorted.bam

Removing duplicated and nested sequences

https://twitter.com/bentemperton/status/1673999868933599232

sample data

$ cat contigs.fa
>big
ACTGACGATCGATACGCAGCACAGCAG
>small_in_big_rc
TGCTGCGTATCG
>small2
ACTACGACTACGACT
>small2_alias
ACTACGACTACGACT
>small2_rc
AGTCGTAGTCGTAGT
>another
ACTAACGA

$ seqkit fx2tab -Q contigs.fa  | csvtk pretty -Ht -W 40 --clip
big               ACTGACGATCGATACGCAGCACAGCAG
small_in_big_rc   TGCTGCGTATCG
small2            ACTACGACTACGACT
small2_alias      ACTACGACTACGACT
small2_rc         AGTCGTAGTCGTAGT
another           ACTAACGA

Step 1. remove exactly duplicated sequences.

$ seqkit rmdup -s -i contigs.fa -o contigs.uniq1.fa
[INFO] 2 duplicated records removed

Step 2. remove nested seqs.

# pair-wise exactly searching
seqkit locate -M -f contigs.uniq1.fa contigs.uniq1.fa -o match.tsv

$ csvtk pretty  -W 40 --clip -t match.tsv
seqID             patternName       pattern                       strand   start   end
---------------   ---------------   ---------------------------   ------   -----   ---
big               small_in_big_rc   TGCTGCGTATCG                  -        10      21
big               big               ACTGACGATCGATACGCAGCACAGCAG   +        1       27
small_in_big_rc   small_in_big_rc   TGCTGCGTATCG                  +        1       12
small2            small2            ACTACGACTACGACT               +        1       15
another           another           ACTAACGA                      +        1       8

# IDs of embeded/nested sequences
$ sed 1d match.tsv \
    | awk '$2 != $1' \
    | cut -f 2 \
    | tee nested.txt
small_in_big_rc

# remove nested sequences
$ seqkit grep -v -f nested.txt contigs.uniq1.fa \
    -o contigs.uniq2.fa

Result

$ seqkit fx2tab -Q contigs.uniq2.fa | csvtk pretty -Ht -W 40 --clip
big       ACTGACGATCGATACGCAGCACAGCAG
small2    ACTACGACTACGACT
another   ACTAACGA

Some manipulations on big genomes

A script memusg is used to check the peek memory usage of seqkit. Usage: memusg [-t] command.

  1. Human genome

    $ seqkit stat hsa.fa
    file    format  type  num_seqs        sum_len  min_len       avg_len      max_len
    hsa.fa  FASTA   DNA        194  3,099,750,718      970  15,978,096.5  248,956,422
    
  2. Build FASTA index (optional, when using flag -2 (--two-pass), some commands will automaticlly build it). For some commands, including subseq, split, sort and shuffle, when input files are (plain or gzipped) FASTA files or stdin, FASTA index would be optional used for rapid acccess of sequences and reducing memory occupation. ATTENTION: the .seqkit.fai file created by SeqKit is a little different from .fai file created by samtools. SeqKit uses full sequence head instead of just ID as key.

    $ memusg -t seqkit faidx --id-regexp "^(.+)$"  hsa.fa -o hsa.fa.seqkit.fai
    
    elapsed time: 10.011s
    peak rss: 177.21 MB
    

    Create common .fai file:

    $ memusg -t seqkit faidx hsa.fa -o hsa.fa.fai2
    
    elapsed time: 10.454s
    peak rss: 172.82 MB
    

    Performance of samtools:

    $ memusg -t samtools faidx hsa.fa
    
    elapsed time: 9.574s
    peak rss: 1.45 MB
    

    Exactly same content:

    $ md5sum hsa.fa.fai*
    21e0c25b4d817d1c19ee8107191b9b31  hsa.fa.fai
    21e0c25b4d817d1c19ee8107191b9b31  hsa.fa.fai2
    
  3. Sorting by sequence length

    $ memusg -t seqkit sort --by-length --reverse --two-pass hsa.fa > hsa.sorted.fa
    [INFO] create and read FASTA index ...
    [INFO] read sequence IDs and lengths from FASTA index ...
    [INFO] 194 sequences loaded
    [INFO] sorting ...
    [INFO] output ...
    
    elapsed time: 4.892s
    peak rss: 500.15 MB
    

    Detail:

    $ seqkit fx2tab --length hsa.sorted.fa --name --only-id | cut -f 1,4 | more
    1       248956422
    2       242193529
    3       198295559
    4       190214555
    5       181538259
    6       170805979
    7       159345973
    X       156040895
    8       145138636
    9       138394717
    11      135086622
    10      133797422
    12      133275309
    13      114364328
    14      107043718
    15      101991189
    16      90338345
    17      83257441
    18      80373285
    20      64444167
    19      58617616
    Y       57227415
    22      50818468
    21      46709983
    KI270728.1      1872759
    KI270727.1      448248
    ...
    
    real    0m10.697s
    user    0m11.153s
    sys     0m0.917s
    
  4. Shuffling sequences

    $ memusg -t seqkit shuffle hsa.fa --two-pass > hsa.shuffled.fa
    [INFO] create and read FASTA index ...
    [INFO] read sequence IDs from FASTA index ...
    [INFO] 194 sequences loaded
    [INFO] shuffle ...
    [INFO] output ...
    
    elapsed time: 6.632s
    peak rss: 528.3 MB
    
  5. Spliting into files with single sequence

    $ memusg -t seqkit split --by-id hsa.fa --two-pass
    [INFO] split by ID. idRegexp: ^([^\s]+)\s?
    [INFO] create and read FASTA index ...
    [INFO] read sequence IDs from FASTA index ...
    [INFO] 194 sequences loaded
    [INFO] write 1 sequences to file: hsa.id_KI270743.1.fa
    [INFO] write 1 sequences to file: hsa.id_KI270706.1.fa
    [INFO] write 1 sequences to file: hsa.id_KI270717.1.fa
    [INFO] write 1 sequences to file: hsa.id_KI270718.1.fa
    [INFO] write 1 sequences to file: hsa.id_KI270468.1.fa
    ...
    
    elapsed time: 18.807s
    peak rss: 1.36 GB
    
  6. Geting subsequence of some chromesomes

    $ memusg -t seqkit subseq -r 1:10 --chr X --chr Y  hsa.fa
    >X_1-10 X dna_sm:chromosome chromosome:GRCh38:X:1:156040895:1 REF
    nnnnnnnnnn
    >Y_1-10 Y dna_sm:chromosome chromosome:GRCh38:Y:2781480:56887902:1 REF
    NNNNNNNNNN
    
    elapsed time: 1.276s
    peak rss: 640.92 MB
    
  7. Geting CDS sequence of chr 1 by GTF files

    $ memusg -t seqkit subseq --gtf Homo_sapiens.GRCh38.84.gtf.gz --chr X --feature cds  hsa.fa > chrX.gtf.cds.fa
    [INFO] read GTF file ...
    [INFO] 22420 GTF features loaded
    
    elapsed time: 8.643s
    peak rss: 846.14 MB
    

Remove contaminated reads

  1. Mapping with reads on some potential contaminate genomes, and get the reads IDs list.

    $ wc -l contaminate.list
    244 contaminate.list
    
    $ head -n 2 contaminate.list
    HWI-D00523:240:HF3WGBCXX:1:1101:2574:2226
    HWI-D00523:240:HF3WGBCXX:1:1101:12616:2205
    
  2. Remove contaminated reads

    $ seqkit grep -f contaminate.list -v reads_1.fq.gz -o reads_1.clean.fq.gz
    $ seqkit grep -f contaminate.list -v reads_2.fq.gz -o reads_2.clean.fq.gz
    
    $ seqkit stat *.fq.gz
    file                  seq_format   seq_type   num_seqs   min_len   avg_len   max_len
    reads_1.clean.fq.gz   FASTQ        DNA           2,256       226       227       229
    reads_1.fq.gz         FASTQ        DNA           2,500       226       227       229
    reads_2.clean.fq.gz   FASTQ        DNA           2,256       223       224       225
    reads_2.fq.gz         FASTQ        DNA           2,500       223       224       225
    

Handling of aligned sequences

  1. Some mock sequences (usually they will be much longer)

    $ cat seqs.fa
    >seq1
    ACAACGTCTACTTACGTTGCATCGTCATGCTGCATTACGTAGTCTGATGATG
    >seq2
    ACACCGTCTACTTTCATGCTGCATTACGTAGTCTGATGATG
    >seq3
    ACAACGTCTACTTACGTTGCATCGTCATGCTGCACTGATGATG
    >seq4
    ACAACGTCTACTTACGTTGCATCTTCGGTCATGCTGCATTACGTAGTCTGATGATG
    
  2. Run multiple sequence alignment (clustalo)

    clustalo -i seqs.fa -o seqs.msa.fa --force --outfmt fasta --threads=4
    
  3. Convert FASTA format to tabular format.

    $ seqkit fx2tab seqs.msa.fa
    seq1    ACAACGTCTACTTACGTTGCAT----CGTCATGCTGCATTACGTAGTCTGATGATG
    seq2    ---------------ACACCGTCTACTTTCATGCTGCATTACGTAGTCTGATGATG
    seq3    ACAACGTCTACTTACGTTGCATCGTCATGCTGCACTGATGATG-------------
    seq4    ACAACGTCTACTTACGTTGCATCTTCGGTCATGCTGCATTACGTAGTCTGATGATG
    

    or

    $ seqkit fx2tab seqs.msa.fa | cut -f 2
    ACAACGTCTACTTACGTTGCAT----CGTCATGCTGCATTACGTAGTCTGATGATG
    ---------------ACACCGTCTACTTTCATGCTGCATTACGTAGTCTGATGATG
    ACAACGTCTACTTACGTTGCATCGTCATGCTGCACTGATGATG-------------
    ACAACGTCTACTTACGTTGCATCTTCGGTCATGCTGCATTACGTAGTCTGATGATG
    

    For me, it's useful when 1) manually assembling Sanger sequencing result, 2) designing site specific PCR primers.

  4. Remove gaps

    $ seqkit seq seqs.msa.fa -g
    >seq1
    ACAACGTCTACTTACGTTGCATCGTCATGCTGCATTACGTAGTCTGATGATG
    >seq2
    ACACCGTCTACTTTCATGCTGCATTACGTAGTCTGATGATG
    >seq3
    ACAACGTCTACTTACGTTGCATCGTCATGCTGCACTGATGATG
    >seq4
    ACAACGTCTACTTACGTTGCATCTTCGGTCATGCTGCATTACGTAGTCTGATGATG
    

Play with miRNA hairpins

Dataset

hairpin.fa.gz from The miRBase Sequence Database -- Release 21

Quick glance

  1. Sequence number

    $ seqkit stat hairpin.fa.gz
    file           format  type  num_seqs    sum_len  min_len  avg_len  max_len
    hairpin.fa.gz  FASTA   RNA     28,645  2,949,871       39      103    2,354
    
  2. First 10 bases

    $ zcat hairpin.fa.gz \
        | seqkit subseq -r 1:10 \
        | seqkit sort -s
        | seqkit seq -s \
        | head -n 10
    AAAAAAAAAA
    AAAAAAAAAA
    AAAAAAAAAG
    AAAAAAAAAG
    AAAAAAAAAG
    AAAAAAAAAU
    AAAAAAAAGG
    AAAAAAACAU
    AAAAAAACGA
    AAAAAAAUUA
    

    hmm, nothing special, non-coding RNA~

Repeated hairpin sequences

We may want to check how may identical hairpins among different species there are. seqkit rmdup could remove duplicated sequences by sequence content, and save the replicates to another file (here is duplicated.fa.gz), as well as replicating details (duplicated.detail.txt, 1th column is the repeated number, 2nd column contains sequence IDs separated by comma).

$ seqkit rmdup -s -i hairpin.fa.gz -o clean.fa.gz -d duplicated.fa.gz -D duplicated.detail.txt

$ head -n 5 duplicated.detail.txt
18      dre-mir-430c-1, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18
16      hsa-mir-29b-2, mmu-mir-29b-2, rno-mir-29b-2, ptr-mir-29b-2, ggo-mir-29b-2, ppy-mir-29b-2, sla-mir-29b, mne-mir-29b, ppa-mir-29b-2, bta-mir-29b-2, mml-mir-29b-2, eca-mir-29b-2, aja-mir-29b, oar-mir-29b-1, oar-mir-29b-2, rno-mir-29b-3
15      dme-mir-125, dps-mir-125, dan-mir-125, der-mir-125, dgr-mir-125-1, dgr-mir-125-2, dmo-mir-125, dpe-mir-125-2, dpe-mir-125-1, dpe-mir-125-3, dse-mir-125, dsi-mir-125, dvi-mir-125, dwi-mir-125, dya-mir-125
13      hsa-mir-19b-1, ggo-mir-19b-1, age-mir-19b-1, ppa-mir-19b-1, ppy-mir-19b-1, ptr-mir-19b-1, mml-mir-19b-1, sla-mir-19b-1, lla-mir-19b-1, mne-mir-19b-1, bta-mir-19b, oar-mir-19b, chi-mir-19b
13      hsa-mir-20a, ssc-mir-20a, ggo-mir-20a, age-mir-20, ppa-mir-20, ppy-mir-20a, ptr-mir-20a, mml-mir-20a, sla-mir-20, lla-mir-20, mne-mir-20, bta-mir-20a, eca-mir-20a

The result shows the most conserved miRNAs among different species, mir-29b, mir-125, mir-19b-1 and mir-20a. And the dre-miR-430c has the most multicopies in Danio rerio.

Hairpins in different species

  1. Before spliting by species, let's take a look at the sequence names.

    $ seqkit seq hairpin.fa.gz -n | head -n 3
    cel-let-7 MI0000001 Caenorhabditis elegans let-7 stem-loop
    cel-lin-4 MI0000002 Caenorhabditis elegans lin-4 stem-loop
    cel-mir-1 MI0000003 Caenorhabditis elegans miR-1 stem-loop
    

    The first three letters (e.g. cel) are the abbreviation of species names. So we could split hairpins by the first letters by defining custom sequence ID parsing regular expression ^([\w]+)\-.

    By default, seqkit takes the first non-space letters as sequence ID. For example,

    FASTA head ID
    >123456 gene name 123456
    >longname longname
    >gi|110645304|ref|NC_002516.2| Pseudomona gi|110645304|ref|NC_002516.2|

    But for some sequences from NCBI, e.g. >gi|110645304|ref|NC_002516.2| Pseudomona, the ID is NC_002516.2. In this case, we could set sequence ID parsing regular expression by flag --id-regexp "\|([^\|]+)\| " or just use flag --id-ncbi. If you want the gi number, then use --id-regexp "^gi\|([^\|]+)\|".

  2. Split sequences by species. A custom ID parsing regular expression is used, ^([\w]+)\-.

    $ seqkit split hairpin.fa.gz -i --id-regexp "^([\w]+)\-" --two-pass
    

    To reduce memory usage when splitting big file, we should always use flag --two-pass

  3. Species with most miRNA hairpins. Third column is the sequences number.

    $ cd hairpin.fa.gz.split/;
    $ seqkit stat hairpin.id_* \
        | csvtk space2tab \
        | csvtk -t sort -k num_seqs:nr \
        | csvtk -t pretty \
        | more
    file                     format   type   num_seqs   sum_len   min_len   avg_len   max_len
    hairpin.id_hsa.fasta     FASTA    RNA    1,881      154,242   82        82        82
    hairpin.id_mmu.fasta     FASTA    RNA    1,193      107,370   90        90        90
    hairpin.id_bta.fasta     FASTA    RNA    808        61,408    76        76        76
    hairpin.id_gga.fasta     FASTA    RNA    740        42,180    57        57        57
    hairpin.id_eca.fasta     FASTA    RNA    715        89,375    125       125       125
    hairpin.id_mtr.fasta     FASTA    RNA    672        231,840   345       345       345
    

    Here, a CSV/TSV tool csvtk is used to sort and view the result.

For human miRNA hairpins

  1. Length distribution. seqkit fx2tab could show extra information like sequence length, GC content. csvtk is used to plot.

    $ seqkit grep -r -p '^hsa' hairpin.fa.gz  \
        | seqkit fx2tab -l \
        | cut -f 4  \
        | csvtk -H plot hist --xlab Length --title "Human pre-miRNA length distribution"
    

    hairpin.id_hsa.fa.gz.lendist.png

    $ seqkit grep -r -p '^hsa' hairpin.fa.gz \
        | seqkit fx2tab -l \
        | cut -f 4 \
        | csvtk -H plot box --xlab Length --horiz --height 1.5
    

    hairpin.id_hsa.fa.gz.lenbox.png

Bacteria genomes

Dataset

Pseudomonas aeruginosa PAO1, files:

Motif distribution

Motifs

$ cat motifs.fa
>GTAGCGS
GTAGCGS
>GGWGKTCG
GGWGKTCG
  1. Sliding. Remember flag --id-ncbi, do you? By the way, do not be scared by the long flag --circle-genome, --step and so on. They have short ones, -c, -s

    $ seqkit sliding --id-ncbi --circular-genome \
        --step 20000 --window 200000 PAO1.fasta -o PAO1.fasta.sliding.fa
    
    $ seqkit stat PAO1.fasta.sliding.fa
    file                   format  type  num_seqs     sum_len  min_len  avg_len  max_len
    PAO1.fasta.sliding.fa  FASTA   DNA        314  62,800,000  200,000  200,000  200,000
    
  2. Locating motifs

    $ seqkit locate --id-ncbi --ignore-case --degenerate \
        --pattern-file motifs.fa  PAO1.fasta.sliding.fa -o  PAO1.fasta.sliding.fa.motifs.tsv
    
  3. Ploting distribution (plot_motif_distribution.R)

    # preproccess
    $ perl -ne 'if (/_sliding:(\d+)-(\d+)\t(.+)/) {$loc= $1 + 100000; print "$loc\t$3\n";} else {print}' PAO1.fasta.sliding.fa.motifs.tsv  > PAO1.fasta.sliding.fa.motifs.tsv2
    
    # plot
    $ ./plot_motif_distribution.R
    

    Result

    motif_distribution.png

Find multicopy genes

  1. Get all CDS sequences

    $ seqkit subseq --id-ncbi --gtf PAO1.gtf --feature cds PAO1.fasta -o PAO1.cds.fasta
    
    $ seqkit stat *.fasta
    file            format  type  num_seqs    sum_len    min_len    avg_len    max_len
    PAO1.cds.fasta  FASTA   DNA      5,572  5,593,306         72    1,003.8     16,884
    PAO1.fasta      FASTA   DNA          1  6,264,404  6,264,404  6,264,404  6,264,404
    
  2. Get duplicated sequences

    $ seqkit rmdup --by-seq --ignore-case PAO1.cds.fasta -o PAO1.cds.uniq.fasta \
        --dup-seqs-file PAO1.cds.dup.fasta --dup-num-file PAO1.cds.dup.text
    
    $ cat PAO1.cds.dup.text
    6       NC_002516.2_500104:501120:-, NC_002516.2_2556948:2557964:+, NC_002516.2_3043750:3044766:-, NC_002516.2_3842274:3843290:-, NC_002516.2_4473623:4474639:+, NC_002516.2_5382796:5383812:-
    2       NC_002516.2_2073555:2075438:+, NC_002516.2_4716660:4718543:+
    2       NC_002516.2_2072935:2073558:+, NC_002516.2_4716040:4716663:+
    2       NC_002516.2_2075452:2076288:+, NC_002516.2_4718557:4719393:+
    

Flanking sequences

  1. Get CDS and 1000 bp upstream sequence

    $ seqkit subseq --id-ncbi --gtf PAO1.gtf \
        --feature cds PAO1.fasta --up-stream 1000
    
  2. Get 1000 bp upstream sequence of CDS, NOT including CDS.

    $ seqkit subseq --id-ncbi --gtf PAO1.gtf \
        --feature cds PAO1.fasta --up-stream 1000 --only-flank